BES_019_002_2011

DESCRIPCIÓN DE LOS GENOTIPOS DE C. TRACHOMATIS EN EL HOSPITAL DE BASURTO-BILBAO

N. Ortiz (1, 2), G. Ezpeleta (2), F. Simón (3), A. Díaz (4), M. Imaz (5), V. Esteban (5), R. Cisterna (5)

(1) Centro Nacional de Epidemiología (CNE), (Programa de Epidemiología Aplicada de Campo - PEAC), ISCIII

(2) Unidad de Investigación en Microbiología Clínica y Epidemiología Molecular; Hospital de Basurto, Bilbao

(3) Dinámica de enfermedades y formación aplicada, CNE, ISCIII

(4) Área de vigilancia de VIH/sida. CNE, ISCIII

(5) Servicio de Microbiología Clínica y Control de Infección, Hospital de Basurto, Bilbao

Resumen

Se describen las características genotípicas de los aislamientos de C. trachomatis en una consulta de infecciones de transmisión sexual (ITS) en Bilbao para valorar la posible introducción de la cepa cwCT, variante aislada en Suecia, en la población diana del hospital de Basurto-Bilbao.

Introducción

En diciembre del 2006 en el condado de Halland, sudeste de Suecia, coincidiendo con un descenso de un 25% en la incidencia de Chlamydia trachomatis 1, se identificó una nueva cepa mutante de C. trachomatis (cwCT variante). Esta variante contiene en su secuencia una deleción de 377 pb en el plásmido críptico, que la hace indetectable con pruebas convencionales disponibles en el mercado, justificando en parte el descenso observado en la incidencia 2-3.

Actualmente, se reconocen 19 serotipos humanos de C. trachomatis mediante anticuerpos monoclonales y policlonales frente a la proteína principal de la membrana externa (MOMP). Los diferentes serotipos presentan manifestaciones clínicas especificas, por ejemplo, los tipos A, B, Ba y C, causan tracoma, los tipos de LGV-L1, L2, y L3 causan Linfogranuloma venereum LGV, y los tipos D a K causan infecciones genitales 4.

C. trachomatis puede ser diagnosticada por cultivo celular, inmunofluorescencia (IF), inmunoensayo enzimático (EIA), hibridación de ADN directa y PCR (test de amplificación de ácidos nucleicos (NAATs). El genotipado de C. trachomatis es también importante para la comprensión de la patogénesis de la infección, las secuelas de la infección, para supervisar el tratamiento y para la localización de contactos 5. En España, hasta la fecha, la vigilancia epidemiológica de C. trachomatis se realiza a través del Sistema de Información Microbiológica a través de la declaración de 18 laboratorios situados en 8 Comunidades Autónomas. Recientemente se ha incluido como enfermedad de declaración obligatoria a nivel europeo, junto con el LGV 6.

Este estudio describe las características genotípicas de los aislamientos de C. trachomatis en una consulta de ITS en Bilbao y valora la posible introducción de la cepa cwCT variante aislada en Suecia, (no detectable con test comerciales) en la población diana del hospital.

Material y métodos

Se realiza una descripción de todos los aislamientos de C. trachomatis identificados por PCR en tiempo real y cultivo positivo, recibidos en el laboratorio de Microbiología del hospital de Basurto en Bilbao, entre enero y diciembre del 2007. En el estudio se incluyeron las variables edad, sexo, tipo de muestra y genotipado. Para el genotipado se utilizó el gen ompA 7. El ensayo consistió en una PCR en tiempo real directa para producir dos amplicones de 480 pares de bases y definir las regiones V1-V2 y V3, V4-del gen ompA utilizando los cebadores descritos en la Tabla 1. La reacción de PCR se llevó a cabo en un volumen de 20 μL y se realizó con el instrumento LightCycler 480. El producto final se secuenció utilizando BigDye Terminator versión 3.1 de acuerdo a las instrucciones del fabricante. Las reacciones de secuenciación se purificaron con AutoSeq G-50 (GE Healthcare). El gen ompA fue secuenciado como describe Klint et al 8. Las secuencias de ADN obtenidas se alinearon y enfrentaron a la base de datos del Basic Local Alignment Search Tool (BLAST) 9-10.

Tabla 1. Secuencias de cebadores usados para la amplificación y secuenciación del gen ompA

Name

Target

Tm(ºC)

Length (nt)

Sequence (5’- 3’) a

a Posición de nucleótidos de primer: Numero de acceso al GenBank n º FM872308

F-II

ompA

60.2

23

ACCACTTGGTGTGACGCTATCAG

MB-22

ompA

60.1

21

CACCCACATTCCCAGAGAGCT

Tabla 2. Distribución de los genotipos de C. trachomatis mediante ompA
en las diferentes muestras recibidas

Población (n.º espécimen)

N.º de aislamientos y genotipos

D/Da

E

F

G

H

I/Ia

J/Ja

K

L2b

Uretral

3

7

11

2

2

1

4

5

Endocervical

4

6

6

1

4

1

4

2

1

Rectal

1

3

1

2

1

Conjuntival

1

Oropharyngeal

1

1

1

1

1

TOTAL (78)

Resultados

Se recibieron 4.182 muestras para el diagnostico de infección por C. trachomatis. De las 211 muestras que fueron positivas mediante la técnica de PCR screening, 96 (2,29% del total) lo fueron también por cultivo. De estas 96 muestras que cumplían los criterios de inclusión, 45 fueron de origen uretral, 33 endocervicales, 11 rectales y 7 de otras localizaciones, las cuales fueron positivas mediante PCR en tiempo real y cultivo y se analizaron por secuenciación. Dieciocho de las 96 muestras no secuenciaron por presentar coinfección con 2 o más genotipos. El 58,3% de las muestras positivas eran de hombres; la edad media de los pacientes variaba según el sexo, siendo las mujeres más jóvenes (27,0 años [DE:7,3] frente a 32,5 [DE:9,2]). Se encontraron 9 diferentes genotipos entre los especímenes de C. trachomatis secuenciados: 18 muestras (18,8%) fueron genotipo F, 14 (14,6%) genotipo E, 12 (12,5%) J/Ja, 8 (8,3%) K, 8 (8,3%) D, 7 (7,9%) G, 7 (7,3%) H, 3 (3,1%) I/Ia, 1 (1.04%) L2b. El genotipo L2b responsable del Linfogranuloma venereum, fue aislado de una muestra endocervical (tabla 2). El genotipo F fue el más frecuente en hombres (27,3%) mientras que en mujeres fue el J/Ja (20,6%). En los menores de 25 años el genotipo predominante fue el J/Ja (27,3%) y en los de 25 y más años el F (26,8%). No se aisló en ninguna muestra el genotipo cwCT variante.

Figura 1. Resultados de la amplificación mediante PCR en tiempo real directa de Chlamydia trachomatis

(A) El eje X muestra el número de ciclos de PCR, el eje de las Y, la intensidad de la fluorescencia normalizada. El ciclo umbral (CT) es el ciclo en el cual la intensidad de fluorescencia cruzo el umbral.

(B) La especificidad del producto amplificado de la RT-PCR es confirmado por el análisis de la curva fusión que alcanzó de forma gradual con una temperatura de 84,4°C. La especificidad de los productos amplificados se comprobó por el análisis de la curva de fusión.

(A)

(B)

2011-0475_fig01_a.pdf

2011-0475_fig01_b.pdf

Figura 2. Producto de PCR de una secuencia de ADN de Chlamydia trachomatis

2011-0475_fig02.pdf

Discusión

El método de secuenciación directa fue desarrollado para la detección y amplificación del ADN clamidial. Este sistema nos permitió identificar los diferentes genotipos de todas las cepas aisladas de C. trachomatis, mediante la detección simultanea de hasta 32 objetivos diferentes de múltiples reacciones en un solo ensayo 8.

Este método nos ha permitido descartar la presencia de la cepa cwCT variante entre los infectados con Chlamydia trachomatis que acuden a la consulta de ITS del hospital de Basurto. Los genotipos predominantes en las muestras recibidas en el hospital de Basurto son el F y E, de forma similar a lo encontrado en otros estudios 11, 12. El único aislamiento del genotipo L2b se identificó de una muestra endocervical. Nuestro estudio identificó una prevalencia del 2,29% de casos confirmados de C. trachomatis en las muestras recibidas. Esta prevalencia esta en el rango de la encontrada por otros investigadores en otras áreas de España entre 0,9-7% 13, 14. Sin embargo, la falta de estudios con similar metodología en la población que atiende la consulta de ITS del hospital de Basurto no nos permite valorar la magnitud de este hallazgo a nivel local.

Debido a la gran diversidad genética, C. trachomatis puede presentar manifestaciones clínicas diferentes según sus genotipos. La vigilancia de la infección por C. trachomatis y la distribución geográfica de sus genotipos es necesaria para un control eficiente de la transmisión 5. La biología molecular es fundamental en la vigilancia eficiente de este patógeno.

Bibliografía

1. van de Laar M, Morré SA, Chlamydia: a Major Challenge for Public Health. Eurosurvillance 2007; 12 (10):304-305.

2. Morré SA, Catsburg A, De Boer M, Spaargaren J, Schirm J, Savelkoul PHM, van Steenbergen J, Swaan C. Monitoring the potential introduction of the Swedish Chlamydia Trachomatis variant (swCT) in the Netherlands. Eurosurveillance 2007; 12:318-320

3. Herrmann B, A new genetic variant of Chlamydia trachomatis Sex Transm Infct 2007; 83: 253-254.

4. Morre S A, Ossewaarde J , Lan J, van Doornum G , Walboomers J, MacLaren D, Meijer C, and van den Brule A. Serotyping and genotyping of genital Chlamydia trachomatis isolates reveal variants of serovars Ba, G, and J as confirmed by omp1 nucleotide sequence analysis. J Clin Microbiol 1998;36: 345-351.

5. Centers for Disease Control and Prevention (CDC) CDC Grand Rounds: Chlamydia Prevention: Challenges and Strategies for Reducing Disease Burden and Sequelae. MMWR Morb Mortal Wkly Rep 2011; 60 (12):370-373

6. Centro Nacional de Epidemiología. Vigilancia Epidemiológica de las infecciones de transmisión sexual, 1995- 2009. Madrid: Centro Nacional de Epidemiología; 2011.

7. Jurstrand M, Falk L, Fredlund H. Lindberg M. Olcen P. Andersson S, Persson K, Albert J, and Backman A. Characterization of Chlamydia trachomatis omp1 genotypes among sexually transmitted disease patients in Sweden. J Clin Microbiol 2004; 39:3915-3919.

8. Klint, M, Fuxelius H, Goldkuhl R, Skarin H, Rutemark Ch, Andersson S G, Persson K, and Herrmann B. High-Resolution genotyping of Chlamydia trachomatis strains by multilocus Sequence Analysis. J Clin Microbiol 2007; 45:1410-1414.

9. Hamid J, Hannah S, Sarah A, Christopher C, and Christopher S. Development of Real-Time PCR Assays for genotyping of Chlamydia trachomatis. J Clin Microbiol 2007; 45:2649-2653.

10. Claas H, Melchers W, de Bruijn I, de Graaf M, van Dijk W, Lindeman J, and Quint W. Detection of Chlamydia trachomatis in clinical specimens by the polymerase chain reaction. Eur. J Clin Microbiol Infect Dis 1990; 9:864-868.

11. Hsu MC, Tsai PY, Chen KT, Li LH, Chiang CC, Tsai JJ, Ke LY, Chen HY and Li SY. Genotyping of Chlamydia trachomatis from clinical specimens in Taiwan. J Med Microbiol 2006; 55:301-308.

12. Lysen A, Österlund A, Rubin C, Persson T, Persson I and Herrmann B. Characterization of ompA genotypes by Sequence Analysis of DNA from all detected cases of Chlamydia trachomatis infections during 1 year of contact tracing in a Swedish county. J. Clin Microbiol 2004; 42(4):1641-47.

13. Reina J, Gutiérrez O, Gonzáles-Cárdenas M, Berlanga R. Prevalencia de infección genital por Chlamydia trachomatis en la población general y en un grupo de prostitutas de Palma de Mallorca. Enferm Infecc Microbiol Clin 2004; 22:439-41.

14. Andreu A, Pumarola T, Sanz B, Sobejano L, Xercavins J, Coll Oriol, López M, Codina G. Prevalencia de infección por Chlamydia trachomatis determinada mediante métodos de biología molecular. Enferm Infecc Microbiol Clin 2002; 20:205-7.





Boletín Epidemiológico Semanal eISSN:2173-9277
Centro Nacional de Epidemiología. Instituto de Salud Carlos III.
C/ Monforte de Lemos, 5, 28029-Madrid.
Tfno: 91 8222775